pines80 addgene plasmid (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc pines80 addgene plasmid
Pines80 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna5/pcDNA5%2FFRT%2FTO-Venus-Flag-Gateway+(1124)+(Plasmid+%2340999)/pm41875887-830-33-34
Average 92 stars, based on 10 article reviews

pines80 addgene plasmid - by Bioz Stars, 2026-09

92/100 stars

Images

Plasmid Preparation:

Article Title: Soluble cyclase-mediated nuclear cAMP synthesis is sufficient for cell proliferation.
Article Snippet: K44A HA-dynamin 1 pcDNA3.1 was a gift from Dr. Sandra Schmid (Addgene plasmid # 34683). .. CMV-NLS-R-GECO was a gift from Robert Campbell (Addgene plasmid #32462). pcDNA5-TO-PV-NES-DsRed (PV-NES; Addgene plasmid #16339) and pcDNA5-TO-PV-NLS-Dsred (PV-NLS; Addgene plasmid #16341) were a gift from Anton Bennet. ..

Article Title: Sae2/CtIP prevents R-loop accumulation in eukaryotic cells
Article Snippet: .. The A206K mutation in eGFP was made to prevent eGFP dimerization, and shRNA resistance mutations introduced to generate pTP3148. pcDNA5-flag-bio-CtIP(wt) (containing N-terminal Flag and biotinylation signal sequences) (pTP3663) was made by Q5 Site-Directed Mutagenesis to remove eGFP, and insert Flag and biotinylation signal sequences. pcDNA5-flag-bio-CtIP(N289A/H290A) (pTP3665) was made using QuikChange II Site-Directed Mutagenesis (Agilent Technologies). shRNA SETX1 (pRSITEP–U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3677) and shRNA XPG (pRSITEP–U6Tet-(sh)-EF1TetRep-2A-HYGRO) (pTP3703) were made from the pRSITEP–U6Tet-(sh)-EF1-TetRep-2A-shRNACtIP construct (Cellecta) using Q5 Site-Directed Mutagenesis, with the shRNA cassettes 5’-GCCAGA TCGTATACAATTATAGTTAATATTCATAGCTATAATTGTATACGATCTGGCTTTT-3 ’ and 5’-GAACGCACCTGCTGCTGTAGAGTTAATATTCATAGCTCTACAGCAGCAGGTGCGTTCTTTT-3 ’, respectively. pcDNA5 with with wild-type RnaseHI (rnhA from E. coli) containing an NLS and fused to mCherry (pTP3492) was generated from pcDNA5/FRT/TO (Invitrogen) and pICE-RNaseHI-mCherry (Addgene 60365, gift from Patrick Calsou). pcDNA5 with NLS-mCherry (pTP3494) was generated from pcDNA5/FRT/TO (invitrogen) and pICE-mCherry (Addgene # 60364). pcDNA5-RNaseHI-D10RE48R-NLS-mCherry (pTP3493) was cloned using pcDNA5/FRO/TO and pICE-RNaseHID10R-E48R-NLSmCherry (a gift from Patrick Calsou, Addgene # 60367 (Britton et al., 2014)). pLenti-PGK-RNaseHID10R-E48R-NLS-mCherry (pTP3660) was cloned using pLenti PGK GFP Blast (w510-5) which was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #19069 [Campeau et al., 2009]) and the RNaseHID10R-E48R-NLS-mCherry fragment from pICE-RNaseHID10R-E48R-NLS-mCherry. pBluescript-Sg3 12 (pTW-121) was a generous gift from Michael Lieber. pcDNA5/FRT/TO-Sg3 12 (pTP4195) was cloned using pcDNA5/FRT/TO and the Sg3 region from pTW-121. pcDNA5/FRT/TOhPCF11 (pTP4195) was cloned using pcDNA5/FRT/TO and the hPCF11 ORF containing plasmid, obtained from Kazusa (ORK06290). ..

Article Title: Sae2/CtIP prevents R-loop accumulation in eukaryotic cells
Article Snippet: .. The A206K mutation in eGFP was made to prevent eGFP dimerization, and shRNA resistance mutations introduced to generate pTP3148. pcDNA5-flag-bio-CtIP(wt) (containing N-terminal Flag and biotinylation signal sequences) (pTP3663) was made by Q5 Site-Directed Mutagenesis to remove eGFP, and insert Flag and biotinylation signal sequences. pcDNA5-flag-bio-CtIP(N289A/H290A) (pTP3665) was made using QuikChange II Site-Directed Mutagenesis (Agilent Technologies). shRNA SETX1 (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3677) and shRNA XPG (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3703) were made from the pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-shRNA-CtIP construct (Cellecta) using Q5 Site-Directed Mutagenesis, with the shRNA cassettes 5ʹ-GCCAGATCGTATACAATTATAGTTAATATTCATAGCTATAATTGTATACGATCTGGCTTTT-3 ʹ and 5ʹ-GAACGCACCTGCTGCTGTAGAGTTAATATTCATAGCTCTACAGCAGCAGGTGCGTTCTTTT-3 ʹ, respectively. pcDNA5 with with wild-type RnaseHI (rnhA from E. coli ) containing an NLS and fused to mCherry (pTP3492) was generated from pcDNA5/FRT/TO (Invitrogen) and pICE-RNaseHI-mCherry (Addgene 60365, gift from Patrick Calsou). pcDNA5 with NLS-mCherry (pTP3494) was generated from pcDNA5/FRT/TO (invitrogen) and pICE-mCherry (Addgene # 60364). pcDNA5-RNaseHI-D10R-E48R-NLS-mCherry (pTP3493) was cloned using pcDNA5/FRO/TO and pICE-RNaseHI D10R-E48R -NLS-mCherry (a gift from Patrick Calsou, Addgene # 60367 ( )). pLenti-PGK-RNaseHI D10R-E48R -NLS-mCherry (pTP3660) was cloned using pLenti PGK GFP Blast (w510-5) which was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #19069 [ ]) and the RNaseHI D10R-E48R -NLS-mCherry fragment from pICE-RNaseHI D10R-E48R -NLS-mCherry. pBluescript-Sγ3 × 12 (pTW-121) was a generous gift from Michael Lieber. pcDNA5/FRT/TO-Sγ3 × 12 (pTP4195) was cloned using pcDNA5/FRT/TO and the Sγ3 region from pTW-121. pcDNA5/FRT/TO-hPCF11 (pTP4195) was cloned using pcDNA5/FRT/TO and the hPCF11 ORF containing plasmid, obtained from Kazusa (ORK06290). ..

Article Title: FAM83B-mediated activation of PI3K/AKT and MAPK signaling cooperates to promote epithelial cell transformation and resistance to targeted therapies
Article Snippet: .. Der (University of North Carolina at Chapel Hill, Addgene Plasmid #12593). pcDNA5/TO-myc-PLD1 and pcDNA5/TO-myc-PLD2 were provided by H. Alex Brown (Vanderbilt University; [ ]) and was subcloned into pLNCX2 (Clontech). phCMV2-HA-PLD1 and phCMV2-HA-PLD1-K830R were kindly provided by Julian Gomez-Cambronero (Wright State University) and subsequently subcloned into pLNCX2. .. LPCX-FLAG-FAM83B, pLKO.1-shFAM83B (#2), and pLKO.1-shGFP were previously described [ ]. pBabepuro-RasV12, pBabepuro-RasV12-Y40C, pBabepuro-RasV12-T35S, and pBabepuro-RasV12-E37G (Addgene plasmids 1768, 12276, 12274, and 12275) were obtained from Addgene, deposited by Dr. Robert Weinberg (Whitehead Institute, Cambridge, MA). pBabe-puro-MEK-DD (Addgene plasmid 15268 ) was obtained from Addgene, deposited by Dr. William Hahn (Dana-Farber Cancer Institute, Boston, MA). pwzl-neo-Myr FLAG AKT1 (Addgene plasmid 20422) was obtained from Addgene, deposited by Dr. Jean Zhao (Dana-Farber Cancer Institute, Boston, MA). pwzl-puro-Myr-p110a was previously described [ ]. pSV-HA-p85 (Addgene plasmid 11499) was obtained from Addgene deposited by Dr. Ronald Kahn (Harvard Medical School, Boston, MA).

Mutagenesis:

Article Title: Sae2/CtIP prevents R-loop accumulation in eukaryotic cells
Article Snippet: .. The A206K mutation in eGFP was made to prevent eGFP dimerization, and shRNA resistance mutations introduced to generate pTP3148. pcDNA5-flag-bio-CtIP(wt) (containing N-terminal Flag and biotinylation signal sequences) (pTP3663) was made by Q5 Site-Directed Mutagenesis to remove eGFP, and insert Flag and biotinylation signal sequences. pcDNA5-flag-bio-CtIP(N289A/H290A) (pTP3665) was made using QuikChange II Site-Directed Mutagenesis (Agilent Technologies). shRNA SETX1 (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3677) and shRNA XPG (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3703) were made from the pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-shRNA-CtIP construct (Cellecta) using Q5 Site-Directed Mutagenesis, with the shRNA cassettes 5ʹ-GCCAGATCGTATACAATTATAGTTAATATTCATAGCTATAATTGTATACGATCTGGCTTTT-3 ʹ and 5ʹ-GAACGCACCTGCTGCTGTAGAGTTAATATTCATAGCTCTACAGCAGCAGGTGCGTTCTTTT-3 ʹ, respectively. pcDNA5 with with wild-type RnaseHI (rnhA from E. coli ) containing an NLS and fused to mCherry (pTP3492) was generated from pcDNA5/FRT/TO (Invitrogen) and pICE-RNaseHI-mCherry (Addgene 60365, gift from Patrick Calsou). pcDNA5 with NLS-mCherry (pTP3494) was generated from pcDNA5/FRT/TO (invitrogen) and pICE-mCherry (Addgene # 60364). pcDNA5-RNaseHI-D10R-E48R-NLS-mCherry (pTP3493) was cloned using pcDNA5/FRO/TO and pICE-RNaseHI D10R-E48R -NLS-mCherry (a gift from Patrick Calsou, Addgene # 60367 ( )). pLenti-PGK-RNaseHI D10R-E48R -NLS-mCherry (pTP3660) was cloned using pLenti PGK GFP Blast (w510-5) which was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #19069 [ ]) and the RNaseHI D10R-E48R -NLS-mCherry fragment from pICE-RNaseHI D10R-E48R -NLS-mCherry. pBluescript-Sγ3 × 12 (pTW-121) was a generous gift from Michael Lieber. pcDNA5/FRT/TO-Sγ3 × 12 (pTP4195) was cloned using pcDNA5/FRT/TO and the Sγ3 region from pTW-121. pcDNA5/FRT/TO-hPCF11 (pTP4195) was cloned using pcDNA5/FRT/TO and the hPCF11 ORF containing plasmid, obtained from Kazusa (ORK06290). ..

shRNA:

Article Title: Sae2/CtIP prevents R-loop accumulation in eukaryotic cells
Article Snippet: .. The A206K mutation in eGFP was made to prevent eGFP dimerization, and shRNA resistance mutations introduced to generate pTP3148. pcDNA5-flag-bio-CtIP(wt) (containing N-terminal Flag and biotinylation signal sequences) (pTP3663) was made by Q5 Site-Directed Mutagenesis to remove eGFP, and insert Flag and biotinylation signal sequences. pcDNA5-flag-bio-CtIP(N289A/H290A) (pTP3665) was made using QuikChange II Site-Directed Mutagenesis (Agilent Technologies). shRNA SETX1 (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3677) and shRNA XPG (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3703) were made from the pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-shRNA-CtIP construct (Cellecta) using Q5 Site-Directed Mutagenesis, with the shRNA cassettes 5ʹ-GCCAGATCGTATACAATTATAGTTAATATTCATAGCTATAATTGTATACGATCTGGCTTTT-3 ʹ and 5ʹ-GAACGCACCTGCTGCTGTAGAGTTAATATTCATAGCTCTACAGCAGCAGGTGCGTTCTTTT-3 ʹ, respectively. pcDNA5 with with wild-type RnaseHI (rnhA from E. coli ) containing an NLS and fused to mCherry (pTP3492) was generated from pcDNA5/FRT/TO (Invitrogen) and pICE-RNaseHI-mCherry (Addgene 60365, gift from Patrick Calsou). pcDNA5 with NLS-mCherry (pTP3494) was generated from pcDNA5/FRT/TO (invitrogen) and pICE-mCherry (Addgene # 60364). pcDNA5-RNaseHI-D10R-E48R-NLS-mCherry (pTP3493) was cloned using pcDNA5/FRO/TO and pICE-RNaseHI D10R-E48R -NLS-mCherry (a gift from Patrick Calsou, Addgene # 60367 ( )). pLenti-PGK-RNaseHI D10R-E48R -NLS-mCherry (pTP3660) was cloned using pLenti PGK GFP Blast (w510-5) which was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #19069 [ ]) and the RNaseHI D10R-E48R -NLS-mCherry fragment from pICE-RNaseHI D10R-E48R -NLS-mCherry. pBluescript-Sγ3 × 12 (pTW-121) was a generous gift from Michael Lieber. pcDNA5/FRT/TO-Sγ3 × 12 (pTP4195) was cloned using pcDNA5/FRT/TO and the Sγ3 region from pTW-121. pcDNA5/FRT/TO-hPCF11 (pTP4195) was cloned using pcDNA5/FRT/TO and the hPCF11 ORF containing plasmid, obtained from Kazusa (ORK06290). ..

Construct:

Article Title: Sae2/CtIP prevents R-loop accumulation in eukaryotic cells
Article Snippet: .. The A206K mutation in eGFP was made to prevent eGFP dimerization, and shRNA resistance mutations introduced to generate pTP3148. pcDNA5-flag-bio-CtIP(wt) (containing N-terminal Flag and biotinylation signal sequences) (pTP3663) was made by Q5 Site-Directed Mutagenesis to remove eGFP, and insert Flag and biotinylation signal sequences. pcDNA5-flag-bio-CtIP(N289A/H290A) (pTP3665) was made using QuikChange II Site-Directed Mutagenesis (Agilent Technologies). shRNA SETX1 (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3677) and shRNA XPG (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3703) were made from the pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-shRNA-CtIP construct (Cellecta) using Q5 Site-Directed Mutagenesis, with the shRNA cassettes 5ʹ-GCCAGATCGTATACAATTATAGTTAATATTCATAGCTATAATTGTATACGATCTGGCTTTT-3 ʹ and 5ʹ-GAACGCACCTGCTGCTGTAGAGTTAATATTCATAGCTCTACAGCAGCAGGTGCGTTCTTTT-3 ʹ, respectively. pcDNA5 with with wild-type RnaseHI (rnhA from E. coli ) containing an NLS and fused to mCherry (pTP3492) was generated from pcDNA5/FRT/TO (Invitrogen) and pICE-RNaseHI-mCherry (Addgene 60365, gift from Patrick Calsou). pcDNA5 with NLS-mCherry (pTP3494) was generated from pcDNA5/FRT/TO (invitrogen) and pICE-mCherry (Addgene # 60364). pcDNA5-RNaseHI-D10R-E48R-NLS-mCherry (pTP3493) was cloned using pcDNA5/FRO/TO and pICE-RNaseHI D10R-E48R -NLS-mCherry (a gift from Patrick Calsou, Addgene # 60367 ( )). pLenti-PGK-RNaseHI D10R-E48R -NLS-mCherry (pTP3660) was cloned using pLenti PGK GFP Blast (w510-5) which was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #19069 [ ]) and the RNaseHI D10R-E48R -NLS-mCherry fragment from pICE-RNaseHI D10R-E48R -NLS-mCherry. pBluescript-Sγ3 × 12 (pTW-121) was a generous gift from Michael Lieber. pcDNA5/FRT/TO-Sγ3 × 12 (pTP4195) was cloned using pcDNA5/FRT/TO and the Sγ3 region from pTW-121. pcDNA5/FRT/TO-hPCF11 (pTP4195) was cloned using pcDNA5/FRT/TO and the hPCF11 ORF containing plasmid, obtained from Kazusa (ORK06290). ..

Generated:

Article Title: Sae2/CtIP prevents R-loop accumulation in eukaryotic cells
Article Snippet: .. The A206K mutation in eGFP was made to prevent eGFP dimerization, and shRNA resistance mutations introduced to generate pTP3148. pcDNA5-flag-bio-CtIP(wt) (containing N-terminal Flag and biotinylation signal sequences) (pTP3663) was made by Q5 Site-Directed Mutagenesis to remove eGFP, and insert Flag and biotinylation signal sequences. pcDNA5-flag-bio-CtIP(N289A/H290A) (pTP3665) was made using QuikChange II Site-Directed Mutagenesis (Agilent Technologies). shRNA SETX1 (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3677) and shRNA XPG (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3703) were made from the pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-shRNA-CtIP construct (Cellecta) using Q5 Site-Directed Mutagenesis, with the shRNA cassettes 5ʹ-GCCAGATCGTATACAATTATAGTTAATATTCATAGCTATAATTGTATACGATCTGGCTTTT-3 ʹ and 5ʹ-GAACGCACCTGCTGCTGTAGAGTTAATATTCATAGCTCTACAGCAGCAGGTGCGTTCTTTT-3 ʹ, respectively. pcDNA5 with with wild-type RnaseHI (rnhA from E. coli ) containing an NLS and fused to mCherry (pTP3492) was generated from pcDNA5/FRT/TO (Invitrogen) and pICE-RNaseHI-mCherry (Addgene 60365, gift from Patrick Calsou). pcDNA5 with NLS-mCherry (pTP3494) was generated from pcDNA5/FRT/TO (invitrogen) and pICE-mCherry (Addgene # 60364). pcDNA5-RNaseHI-D10R-E48R-NLS-mCherry (pTP3493) was cloned using pcDNA5/FRO/TO and pICE-RNaseHI D10R-E48R -NLS-mCherry (a gift from Patrick Calsou, Addgene # 60367 ( )). pLenti-PGK-RNaseHI D10R-E48R -NLS-mCherry (pTP3660) was cloned using pLenti PGK GFP Blast (w510-5) which was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #19069 [ ]) and the RNaseHI D10R-E48R -NLS-mCherry fragment from pICE-RNaseHI D10R-E48R -NLS-mCherry. pBluescript-Sγ3 × 12 (pTW-121) was a generous gift from Michael Lieber. pcDNA5/FRT/TO-Sγ3 × 12 (pTP4195) was cloned using pcDNA5/FRT/TO and the Sγ3 region from pTW-121. pcDNA5/FRT/TO-hPCF11 (pTP4195) was cloned using pcDNA5/FRT/TO and the hPCF11 ORF containing plasmid, obtained from Kazusa (ORK06290). ..

Clone Assay:

Article Title: Sae2/CtIP prevents R-loop accumulation in eukaryotic cells
Article Snippet: .. The A206K mutation in eGFP was made to prevent eGFP dimerization, and shRNA resistance mutations introduced to generate pTP3148. pcDNA5-flag-bio-CtIP(wt) (containing N-terminal Flag and biotinylation signal sequences) (pTP3663) was made by Q5 Site-Directed Mutagenesis to remove eGFP, and insert Flag and biotinylation signal sequences. pcDNA5-flag-bio-CtIP(N289A/H290A) (pTP3665) was made using QuikChange II Site-Directed Mutagenesis (Agilent Technologies). shRNA SETX1 (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3677) and shRNA XPG (pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-HYGRO) (pTP3703) were made from the pRSITEP--U6Tet-(sh)-EF1-TetRep-2A-shRNA-CtIP construct (Cellecta) using Q5 Site-Directed Mutagenesis, with the shRNA cassettes 5ʹ-GCCAGATCGTATACAATTATAGTTAATATTCATAGCTATAATTGTATACGATCTGGCTTTT-3 ʹ and 5ʹ-GAACGCACCTGCTGCTGTAGAGTTAATATTCATAGCTCTACAGCAGCAGGTGCGTTCTTTT-3 ʹ, respectively. pcDNA5 with with wild-type RnaseHI (rnhA from E. coli ) containing an NLS and fused to mCherry (pTP3492) was generated from pcDNA5/FRT/TO (Invitrogen) and pICE-RNaseHI-mCherry (Addgene 60365, gift from Patrick Calsou). pcDNA5 with NLS-mCherry (pTP3494) was generated from pcDNA5/FRT/TO (invitrogen) and pICE-mCherry (Addgene # 60364). pcDNA5-RNaseHI-D10R-E48R-NLS-mCherry (pTP3493) was cloned using pcDNA5/FRO/TO and pICE-RNaseHI D10R-E48R -NLS-mCherry (a gift from Patrick Calsou, Addgene # 60367 ( )). pLenti-PGK-RNaseHI D10R-E48R -NLS-mCherry (pTP3660) was cloned using pLenti PGK GFP Blast (w510-5) which was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #19069 [ ]) and the RNaseHI D10R-E48R -NLS-mCherry fragment from pICE-RNaseHI D10R-E48R -NLS-mCherry. pBluescript-Sγ3 × 12 (pTW-121) was a generous gift from Michael Lieber. pcDNA5/FRT/TO-Sγ3 × 12 (pTP4195) was cloned using pcDNA5/FRT/TO and the Sγ3 region from pTW-121. pcDNA5/FRT/TO-hPCF11 (pTP4195) was cloned using pcDNA5/FRT/TO and the hPCF11 ORF containing plasmid, obtained from Kazusa (ORK06290). ..

Article Title: Rapid characterization of spike variants via mammalian cell surface display
Article Snippet: .. For mammalian surface display, spike was cloned into a pcDNA5-based vector (Addgene #113547) with the following additional N-terminal Ig-Kappa leader and C-terminal epitopes ordered as two separate gBlocks (IDT): a 3X-FLAG, a Strep Tag II epitope, an HRV 3C protease site, and a PDGFR-β transmembrane domain. .. All three parts (N-terminal leader, spike, and C-terminal additions) were assembled with the pcDNA5 backbone using Hi-Fi DNA assembly (NEB; E2621S).

Strep-tag:

Recombinant:

Article Title: Regulation of transcription patterns, poly(ADP-ribose), and RNA-DNA hybrids by the ATM protein kinase.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies FLAG M2 antibody Millipore Sigma F1804 Biological samples Human brain samples, frozen (See Table S1) NIH Neurobiobank N/A Chemicals, peptides, and recombinant proteins penicillin-streptomycin Millipore Sigma P4333 fetal bovine serum Thermo Fisher 26400044 retinoic acid Sigma R2625 BDNF R&D Systems 248-BDB-250 hygromycin Millipore Sigma 400052 AZD1390 Selleckchem S8680 N-acetyl cysteine Sigma A9165 CM-H2DCFDA Thermo Fisher C6827 formaldehyde Sigma F1635 protease inhibitor Thermo Fisher A32955 anti-pan-ADP-ribose binding reagent Millipore Sigma MABE1016 protein A/G magnetic beads Thermo Fisher 88803 Critical commercial assays Oxiselect comet assay kit Fisher STA-350 Deposited data ChIP and RNAseq datasets GEO GEO: GSE233479 Experimental models: Cell lines Human SH-SY5Y neuroblastoma cells ATCC CRL-2266 human HEK-293T cells ATCC CRL-11268 Oligonucleotides NEBNext Multiplex dual index primers NEB E7500S Recombinant DNA tet-on allele of Flag-RNaseH D210N in a pLenti Hygro H2B mRuby backbone This study pTP5135 C terminus of Senataxin in pcDNA5 This study pTP4764 pLentiPGK Hygro DEST H2B-mRuby2 Addgene 90236 Software and algorithms OpenComet N/A https://cometbio.org/ Fast Gene Set Enrichment Analysis R package N/A https://bioconductor.org/packages/fgsea code to calculate the 100nt rolling mean ChIP signal across the genome N/A https://github.com/prwoolley/ ATM_par_rchip_paper/tree/main. .. Other nucleotide removal kit Qiagen 28306 NEBNext Ultra II DNA Library Prep Kit for Illumina NEB E7645L RNA Extraction kit for Bioruptor Plus Diagenode C20000010 RNeasy mini kit Qiagen 74104 NEBNext Ultra II RNA Library Prep for Illumina NEB E7770S SPRIselect beads Beckman Coulter B23317 NEB Monarch Total RNA Miniprep Kit NEB T2010S phase lock columns VWR 10847–802 16 Cell Reports 43, 113896, March 26, 2024

Review

pines80 addgene plasmid (Addgene inc)

Structured Review

Images

Related Articles

Plasmid Preparation:

Mutagenesis:

shRNA:

Construct:

Generated:

Clone Assay:

Strep-tag:

Recombinant:

Protease Inhibitor:

Binding Assay:

Magnetic Beads:

Single Cell Gel Electrophoresis:

Chromatin Immunoprecipitation:

RNA sequencing:

Multiplex Assay:

Software:

Similar Products

Image Search Results